View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0814_high_18 (Length: 381)
Name: NF0814_high_18
Description: NF0814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0814_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 99 - 368
Target Start/End: Complemental strand, 10221479 - 10221220
Alignment:
Q |
99 |
aataaaattggtgtgcattctttgagtcgtgtcttgcacacattgttatttctatattctttactttgatcatctttgtccccacaaatacttggtttac |
198 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10221479 |
aataaaattggtgtgcattctttgagtcgtgtcttgcacacattgttatgtctatattctttactttgatcatctttgtccccacaaatact-------- |
10221388 |
T |
 |
Q |
199 |
ctatttgttgcatcatgtattgtctcaagaattggtcctacaaaattgtattaaatcaacttccaatgattttactctaacaggtggaaccagctgttga |
298 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10221387 |
--atttgttgcatcatgtattgtctcaagaattggtcctacaaaattgtattaaatcaacttccaatgattttactctaacaggtggaaccagctgttga |
10221290 |
T |
 |
Q |
299 |
ggtctaccatgacaaggaatatagatcaaagatatggaaattcccctctcacaacttcacactctcagta |
368 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10221289 |
ggtctaccatgacaaggaatatagatcaaagatatggaaattcccctctcacaacttcacactctcagta |
10221220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University