View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0814_high_28 (Length: 312)
Name: NF0814_high_28
Description: NF0814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0814_high_28 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 30 - 312
Target Start/End: Complemental strand, 18151726 - 18151442
Alignment:
| Q |
30 |
gttcaaagcaaactctcacccattagatgataaggctatataaacacctccaactgggattgcaagtaaaaagaatgagtaacaatacaaatatagcgaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18151726 |
gttcaaagcaaactctcacccattagatgataaggctatataaacacctccaactgggattgcaagtaaaaagaatgagtaacaatacaaatatagcgaa |
18151627 |
T |
 |
| Q |
130 |
tctaaatgtatgaacaccaatacat--gagtaacaatacagaatagagaactttcaagtatctataaactttccataattttttgttctacaactatatc |
227 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18151626 |
tctaaatgtatgaacaccaatacatatgagtaacaatacaaaatagagaactttcaagtatctataaactttccataattttttgttctacaactatatc |
18151527 |
T |
 |
| Q |
228 |
tagagaactttattcaaaatagctcttggtaaaacaatcttagtattggttatgacatacctaacttcaactgtttcctttcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18151526 |
tagagaactttattcaaaatagctcttggtaaaacaatcttagtattggttatgacatacctaacttcaactgtttcctttcaaa |
18151442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University