View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0814_high_36 (Length: 283)

Name: NF0814_high_36
Description: NF0814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0814_high_36
NF0814_high_36
[»] chr1 (1 HSPs)
chr1 (61-134)||(34979248-34979321)


Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 61 - 134
Target Start/End: Complemental strand, 34979321 - 34979248
Alignment:
61 caagtcttttcatgttgccttctatatacaatttgattagtgcaaagaatacaaaaagaaaaggatttgattag 134  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
34979321 caagtcttttcatgttgccgtctatatacaatttgattagtgcaaagaatacaaaaagaaaagtatttgattag 34979248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University