View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0814_low_38 (Length: 304)
Name: NF0814_low_38
Description: NF0814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0814_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 81 - 267
Target Start/End: Complemental strand, 55182788 - 55182611
Alignment:
| Q |
81 |
atatcttgattatggttttcttgtggcttatctaatgaatgagacagatactcttgctcatcaaattgatggtcggtgtttgtgtgatcgatcaaatttt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
55182788 |
atatcttgattatggttttcttgtggcttatctaatga----gccagatactcttgctcatcaaattgatggttggtgtttgtgtgatcgatcaaatttt |
55182693 |
T |
 |
| Q |
181 |
tacatgaaaacttgtacaattatctgaccaacaacaatataatttagtccatttgaaaaaggaggaataaattgagttttacaaatc |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55182692 |
tacatgaaaacttgtacaattatctgaccaacaac-----aatttagtccatttgaaaaaggaggaacaaattgagttttacaaatc |
55182611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University