View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0814_low_42 (Length: 285)
Name: NF0814_low_42
Description: NF0814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0814_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 61 - 134
Target Start/End: Complemental strand, 34979321 - 34979248
Alignment:
Q |
61 |
caagtcttttcatgttgccttctatatacaatttgattagtgcaaagaatacaaaaagaaaaggatttgattag |
134 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
34979321 |
caagtcttttcatgttgccgtctatatacaatttgattagtgcaaagaatacaaaaagaaaagtatttgattag |
34979248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University