View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0814_low_50 (Length: 265)
Name: NF0814_low_50
Description: NF0814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0814_low_50 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 33 - 239
Target Start/End: Complemental strand, 16134 - 15928
Alignment:
| Q |
33 |
gacacaaggtatgcatctgattcctcaaaaaggagctttacccacccaaccaccaggctccccaactggataaaagaccgcctcgtttcttcttccagaa |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16134 |
gacacaaggtatgcatctgattcctcaaaaaggagctttacccacccaaccaccaagctccccaactggataaaagaccgcctcgtttcttcttccagaa |
16035 |
T |
 |
| Q |
133 |
actatggggaagtgcataagttgctgagtcagtttttcaaactcaaaaagacatgttgccaatagtcactgcattagatcttgcaaagccgtgatttcca |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16034 |
actatggggaagtgcataagttgctgagtcagtttttcaaactcaaaaagacatgttgccaatagtcactgcattagatcttgcaaagccgtgatttcca |
15935 |
T |
 |
| Q |
233 |
ttatatt |
239 |
Q |
| |
|
||||||| |
|
|
| T |
15934 |
ttatatt |
15928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University