View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0814_low_51 (Length: 264)
Name: NF0814_low_51
Description: NF0814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0814_low_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 40654499 - 40654240
Alignment:
| Q |
1 |
atgttttccgattttcagcttcagtaagggtaaagcaaaagtctgtacaaaatctgacttcttttgcacttgttctaattaacatgcctaatttttcatt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40654499 |
atgtttttcgattttcagcttcagtaagggtaaagcaaaagtctgtacaaaatctgacttcttttgcacttgttctaattaacatgcctaatttttcatt |
40654400 |
T |
|
| Q |
101 |
gtgatttggaacgagtctattctatgagatcttttggtggattgtcaatccaatcattcaaataaaaagagaaacaaaaatggagtgctgaaatttcagc |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40654399 |
gtgatttggaatgagtctattctatgagatcttttggtggattgtcaatccaatcattcaaataaaaagagaaacaaaaatggagtgctgaaatttcagc |
40654300 |
T |
|
| Q |
201 |
aatcatttgcttcttcatctttcacctcctccccctcctgcttttacagaataatctacc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |||| |
|
|
| T |
40654299 |
aatcatttgcttcttcatctttcacctcctccccctgctgcttttacagattaatttacc |
40654240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University