View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0814_low_63 (Length: 202)
Name: NF0814_low_63
Description: NF0814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0814_low_63 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 32990014 - 32989932
Alignment:
| Q |
18 |
cacgcgacgctgggacctctgatcaatggatcaaacggaacacctcaatgctccgtctgacaggaaaacaccccttcatctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32990014 |
cacgcgacgctgggacctctgatcaatggatcaaacggaacacctcaatgctccgtctgacaggaaaacaccccttcaactca |
32989932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University