View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0815_high_16 (Length: 225)

Name: NF0815_high_16
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0815_high_16
NF0815_high_16
[»] chr8 (1 HSPs)
chr8 (1-147)||(4328131-4328277)


Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 4328131 - 4328277
Alignment:
1 tgatgctcacaatccttcacaacgacaccacctctaaacccctcttgaggtagcaaaccctgggaatttctctggttgtttgatagatatgggttttggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4328131 tgatgctcacaatccttcacaacgacaccacctctaaacccctcttgaggtagcaaaccctgggaatttctctggttgtttgatagatatgggttttggt 4328230  T
101 ttggatcgtgttttattcgtcgtagtcaatttgaatctcttagatct 147  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||    
4328231 ttggatcgtgttttattcgtcgtagtcaatttgagtctcttagatct 4328277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University