View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0815_high_4 (Length: 392)
Name: NF0815_high_4
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0815_high_4 |
 |  |
|
[»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 33 - 381
Target Start/End: Complemental strand, 16134 - 15785
Alignment:
Q |
33 |
gacacaaggtatgcatctgattcctcaaaaaggagctttacccacccaaccaccaggctccccaactggataaaagaccgcctcgtttcttcttccagaa |
132 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16134 |
gacacaaggtatgcatctgattcctcaaaaaggagctttacccacccaaccaccaagctccccaactggataaaagaccgcctcgtttcttcttccagaa |
16035 |
T |
 |
Q |
133 |
actatggggaagtgcataagttgctgagtcagtttttcaaactcaaaaagacatgttgccaatagtcactgcattagatcttgcaaagccgtgatttcca |
232 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16034 |
actatggggaagtgcataagttgctgagtcagtttttcaaactcaaaaagacatgttgccaatagtcactgcattagatcttgcaaagccgtgatttcca |
15935 |
T |
 |
Q |
233 |
ttata-ttattcattcattcatttataactcaactctatcctgatttggtaatactttttactagtacttaacataaatatttttcacgaaaagatagaa |
331 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15934 |
ttatatttattcattcattcatttataactcaactctatcctgatttggtaatactttttactagtacttaacataaatatttttcacgaaaagatagaa |
15835 |
T |
 |
Q |
332 |
caaggagaaattgcacagcaggttcaattgactcttatgatcatgttcat |
381 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15834 |
caaggagaaattgcacagcaggttcaattgactcttatgatcatgttcat |
15785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University