View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0815_high_8 (Length: 271)
Name: NF0815_high_8
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0815_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 34442144 - 34442275
Alignment:
Q |
1 |
gaagccagtgttttcatggaagcaacaagcacctcttgcgatgcatgatatgcactagaatgtgtggcttccagtcactcacactccaagattatgtctt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
34442144 |
gaagccagtgttttcatggaagcaacaagcacctcttgcgatgcatgatatgcactagaatgcgtggcttccagtcactcacactccaagattatgtctt |
34442243 |
T |
 |
Q |
101 |
tgaaggaaagactcaactcttcttccacaggt |
132 |
Q |
|
|
||||||||||||||||||||||||||| |||| |
|
|
T |
34442244 |
tgaaggaaagactcaactcttcttccataggt |
34442275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University