View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0815_high_8 (Length: 271)

Name: NF0815_high_8
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0815_high_8
NF0815_high_8
[»] chr7 (1 HSPs)
chr7 (1-132)||(34442144-34442275)


Alignment Details
Target: chr7 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 34442144 - 34442275
Alignment:
1 gaagccagtgttttcatggaagcaacaagcacctcttgcgatgcatgatatgcactagaatgtgtggcttccagtcactcacactccaagattatgtctt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
34442144 gaagccagtgttttcatggaagcaacaagcacctcttgcgatgcatgatatgcactagaatgcgtggcttccagtcactcacactccaagattatgtctt 34442243  T
101 tgaaggaaagactcaactcttcttccacaggt 132  Q
    ||||||||||||||||||||||||||| ||||    
34442244 tgaaggaaagactcaactcttcttccataggt 34442275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University