View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0815_high_9 (Length: 270)
Name: NF0815_high_9
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0815_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 34442168 - 34442025
Alignment:
| Q |
1 |
ttgcttccatgaaaacactggcttcagcgtcacacgatccaagatgtgcaaaatatagactatgaagaatccaaatataatatgaagaaatcgtaaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34442168 |
ttgcttccatgaaaacactggcttcagcgtcacacgatccaagatgtgcaaaatatagactatgaagaatccaaatataatatgaagaaatcgtaaagga |
34442069 |
T |
 |
| Q |
101 |
ggagtcaccatctggaacagttggtggtgtgcagggtttgttac |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34442068 |
ggagtcaccatctggaacagttggtggtgtgcagggtttgttac |
34442025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University