View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0815_high_9 (Length: 270)

Name: NF0815_high_9
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0815_high_9
NF0815_high_9
[»] chr7 (1 HSPs)
chr7 (1-144)||(34442025-34442168)


Alignment Details
Target: chr7 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 34442168 - 34442025
Alignment:
1 ttgcttccatgaaaacactggcttcagcgtcacacgatccaagatgtgcaaaatatagactatgaagaatccaaatataatatgaagaaatcgtaaagga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34442168 ttgcttccatgaaaacactggcttcagcgtcacacgatccaagatgtgcaaaatatagactatgaagaatccaaatataatatgaagaaatcgtaaagga 34442069  T
101 ggagtcaccatctggaacagttggtggtgtgcagggtttgttac 144  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
34442068 ggagtcaccatctggaacagttggtggtgtgcagggtttgttac 34442025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5816 times since January 2019
Visitors: 5759