View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0815_low_10 (Length: 329)
Name: NF0815_low_10
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0815_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 34442247 - 34442563
Alignment:
Q |
1 |
aggaaagactcaactcttcttccataggtgcatcctcggtcaatatctccaacattaattcggatgtgacctacaaaataaaaaatgattagaaaaattg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
34442247 |
aggaaagactcaactcttcttccataggtgcatcctcggtcaatatctccaacattaattcggatgtgacctacaaaataaaaaatgattataaaaattg |
34442346 |
T |
 |
Q |
101 |
tggcgtgacattgtcactgccgttaagaggatttatccacctcataagtgcgagtcccccaaaatatacaacatgatcttcctgagtgatgtcactatgt |
200 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34442347 |
tgacgtgacattgtcactgccgttaagaggatttatccacctcataagtgcgagtcccccaaaatatacaacatgatcttcctgagtgatgtcactatgt |
34442446 |
T |
 |
Q |
201 |
cgtgttgtatgatgtgttttagaannnnnnnnnnnatgcattttagataagtcttaagtagttttagacagtttggagatgaaaatatcaagaaaatcaa |
300 |
Q |
|
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34442447 |
cgtgttgtatgatgtgttttagaa----tttttttatgcattttcgataagtcttaagtagttttagacagtttggagatgaaaatatcaagaaaatcaa |
34442542 |
T |
 |
Q |
301 |
ggttcctgatccagaataatc |
321 |
Q |
|
|
|||||||| ||||||| |||| |
|
|
T |
34442543 |
ggttcctggtccagaacaatc |
34442563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University