View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0815_low_11 (Length: 322)
Name: NF0815_low_11
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0815_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 96 - 247
Target Start/End: Original strand, 27843978 - 27844130
Alignment:
| Q |
96 |
atcaatcaagcccttaaaatgcagcggcgtttgaaactcttgagggaaagctttgcggtcctatctagcttgaggacta-tctctacagttgtgcacaga |
194 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
27843978 |
atcaatcaagcccttaaaatgcagtggcgtttgaaactcttgagggaaagctttgcggtcctatctagctttaggactagtctctacagttgtgcacaga |
27844077 |
T |
|
| Q |
195 |
taatacccaagtttacacccnnnnnnntaccagctttcaactaaggcaacagc |
247 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
27844078 |
taatacccaagtttacccccaaaaaaataccagctttcaactaaggcaacagc |
27844130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5959 times since January 2019
Visitors: 5761