View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0815_low_15 (Length: 256)
Name: NF0815_low_15
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0815_low_15 |
 | |
|
| [»] scaffold0147 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 16030 - 15785
Alignment:
| Q |
1 |
tggggaagtgcataagttgctgaatcagtttttcaaactcaaaaagacatgttgccaatagtcactgcattagatcttgcaaagccgtgatttccattat |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16030 |
tggggaagtgcataagttgctgagtcagtttttcaaactcaaaaagacatgttgccaatagtcactgcattagatcttgcaaagccgtgatttccattat |
15931 |
T |
|
| Q |
101 |
att-attcattcattcatttataactcaactctatcctgatttggtaatactttttactagtacttaacataaatatttttcacgaaaagatagaacaag |
199 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15930 |
atttattcattcattcatttataactcaactctatcctgatttggtaatactttttactagtacttaacataaatatttttcacgaaaagatagaacaag |
15831 |
T |
|
| Q |
200 |
gagaaattgcacagcaggttcaattgactcttatgatcatgttcat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15830 |
gagaaattgcacagcaggttcaattgactcttatgatcatgttcat |
15785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5646 times since January 2019
Visitors: 5758