View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0815_low_16 (Length: 253)
Name: NF0815_low_16
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0815_low_16 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 30 - 253
Target Start/End: Complemental strand, 2034540 - 2034317
Alignment:
| Q |
30 |
ggtagtccgtgaattttaggcagaccagttgtttcaggtaaactgtatcctctttcaagtgtttccgcttccataggcagctcctccaagtcctacaacg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2034540 |
ggtagtccgtgaattttaggcagaccagttgtttcaggtaaactgtatcctctttcaagtgtttccgcttccataggcagctcctccaagtcctacaacg |
2034441 |
T |
|
| Q |
130 |
ataaaatacagtcatcctaccaccagcttttaagtaaaaaagctaacaaaaataaataaatcttcaattatatacatttggaagtagtagcgagaagaat |
229 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2034440 |
ataaaatacagtcatcctaccaccaacttttaagtaaaaaagctaacaaaaataaataaatcttcaattatatacatttggaagtagtagcgagaagaat |
2034341 |
T |
|
| Q |
230 |
ttgactcaataacaccgagttgtt |
253 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2034340 |
ttgactcaataacaccgagttgtt |
2034317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5858 times since January 2019
Visitors: 5760