View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0815_low_18 (Length: 251)
Name: NF0815_low_18
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0815_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 11 - 168
Target Start/End: Original strand, 2033953 - 2034110
Alignment:
| Q |
11 |
ttattctgtgtttaagttgtttggtctgacattgtggaaatgtgtggtctttggtgctcatgatctccctgttctgttacctgtgtatttaatatgtatg |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2033953 |
ttattccgtgtttaagttgtttggtctgacattgtggaaatgtgtggtctttggtgctcatgatctccgtgttctgttacctgtgtatttaatatgtatg |
2034052 |
T |
|
| Q |
111 |
cattcaacctatattaatggtaattgattagtttagtattcacggtctatttgttctg |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2034053 |
cattcaacctatattaatggtaattgattagtttagtattcacggtctatttgttctg |
2034110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 198 - 251
Target Start/End: Original strand, 2034140 - 2034193
Alignment:
| Q |
198 |
ggctttcgttatatttggttctcatgtggtgcacttacctatgtttctggtaat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2034140 |
ggctttcgttatatttggttctcatgtggtgcacttacctatgtttctggtaat |
2034193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6528 times since January 2019
Visitors: 5768