View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0815_low_20 (Length: 248)

Name: NF0815_low_20
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0815_low_20
NF0815_low_20
[»] chr8 (1 HSPs)
chr8 (1-235)||(4328131-4328365)


Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 4328131 - 4328365
Alignment:
1 tgatgctcacaatccttcacaacgacaccacctctaaacccctcttgaggtagcaaaccctgggaatttctctggttgtttgatagatatgggttttggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4328131 tgatgctcacaatccttcacaacgacaccacctctaaacccctcttgaggtagcaaaccctgggaatttctctggttgtttgatagatatgggttttggt 4328230  T
101 ttggatcgtgttttattcgtcgtagtcaatttgaatctcttagatcttggtttctgctcaaaccttgcatgggctgcctaaatttccactagcaaattca 200  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
4328231 ttggatcgtgttttattcgtcgtagtcaatttgagtctcttagatcttggtttctgctcaaaccttgcatgggctgccaaaatttccactagcaaattca 4328330  T
201 tgtccccgacatgttctgtgttactattcgtctct 235  Q
    |||||||||||||||||||||||||||||||||||    
4328331 tgtccccgacatgttctgtgttactattcgtctct 4328365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University