View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0815_low_21 (Length: 225)
Name: NF0815_low_21
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0815_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 4328131 - 4328277
Alignment:
Q |
1 |
tgatgctcacaatccttcacaacgacaccacctctaaacccctcttgaggtagcaaaccctgggaatttctctggttgtttgatagatatgggttttggt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4328131 |
tgatgctcacaatccttcacaacgacaccacctctaaacccctcttgaggtagcaaaccctgggaatttctctggttgtttgatagatatgggttttggt |
4328230 |
T |
 |
Q |
101 |
ttggatcgtgttttattcgtcgtagtcaatttgaatctcttagatct |
147 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
4328231 |
ttggatcgtgttttattcgtcgtagtcaatttgagtctcttagatct |
4328277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University