View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_101 (Length: 251)
Name: NF0816_high_101
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_high_101 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 6091154 - 6091022
Alignment:
| Q |
1 |
tttcaaaccctctatttcgtcttaattcttgttgttggatgtttgtatttttctcggggcgaataccctttatccttttcatgaattattaaatactcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6091154 |
tttcaaaccctctatttcgtcttaattcttgttgttggatgtttgtatttttttcagggcgaataccctttatccttttcatgaattattaaatgctcca |
6091055 |
T |
|
| Q |
101 |
tatacttctttcattatttaataatttgttgtt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6091054 |
tatacttctttcattatttaataatttgttgtt |
6091022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7153 times since January 2019
Visitors: 5774