View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_102 (Length: 251)
Name: NF0816_high_102
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_high_102 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 98 - 243
Target Start/End: Complemental strand, 34962067 - 34961922
Alignment:
| Q |
98 |
aatatagacttggattggtcctcatagattggtccggtggtgtagatatctctagtttgaatcttctcgacgtcaattcttgtgattagtctatatgtaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||| |
|
|
| T |
34962067 |
aatatagacttggattggtcctcatagattggtccggtggtgtagatatctctagtttgaatcttctcaacatcaattcttgtgattagtttatatgtaa |
34961968 |
T |
|
| Q |
198 |
tcttgttctgactttaaatggaactctcattggaaatagtataatc |
243 |
Q |
| |
|
||||||||||||||||||| ||||| || |||||||||||| |||| |
|
|
| T |
34961967 |
tcttgttctgactttaaatagaactttcgttggaaatagtagaatc |
34961922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 58 - 158
Target Start/End: Complemental strand, 34962167 - 34962067
Alignment:
| Q |
58 |
tgactatttatgaatagatttcaagattaaaatgactaataatatagacttggattggtcctcatagattggtccggtggtgtagatatctctagtttga |
157 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34962167 |
tgactatttataaatagatttcaagattaaaatgactaataatatagacttggattggtcctcatagattggtccggtggtgtagatatctctagtttga |
34962068 |
T |
|
| Q |
158 |
a |
158 |
Q |
| |
|
| |
|
|
| T |
34962067 |
a |
34962067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7121 times since January 2019
Visitors: 5774