View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_104 (Length: 248)
Name: NF0816_high_104
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_high_104 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 25 - 248
Target Start/End: Original strand, 9237127 - 9237350
Alignment:
| Q |
25 |
atcaactttatttttgaattatctccacttagtttgtgtttaactttcattcattttcatagcatcacttttgctaaaaataatgacattcatgcctttc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9237127 |
atcaactttatttttgaattatctccacttagtttgtgtttaactttcatttattttcatagcatcacttttgctaaaaataatgacattcatgccttta |
9237226 |
T |
 |
| Q |
125 |
gacaatttttgttttcaaatgtttacaaaatcggctcgtttgacaaatgggaacgcaactatcaagttggtaaaaccatgtagaaaatcgtggtatatca |
224 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9237227 |
gacaatttttgttttcaaacgtttacaaaatcggctcgtttgacaaatgggaacgcaactatcaagttggtaaaaccatgtagaaaatcgtggtatatca |
9237326 |
T |
 |
| Q |
225 |
caaactcagactatacgactagtc |
248 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
9237327 |
caaactcagactatacgactagtc |
9237350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University