View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_106 (Length: 247)
Name: NF0816_high_106
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_high_106 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 144 - 243
Target Start/End: Complemental strand, 25699880 - 25699782
Alignment:
| Q |
144 |
cacatacatgtagggatgatattgagtatctatgggtaaaataatatgatatttctgcacatttcgttgaataaatctaacccgttgtttacttcatatc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
25699880 |
cacatacatgtagggatgatattgagtatctatgggtaaaataatatgatatttctgctcatttcgttgaataaatctaacttg-tgtttacttcatatc |
25699782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 25700026 - 25699949
Alignment:
| Q |
1 |
ttttgtgaaaatagttaaactaattgcttgaatcatttagatttataagagaacgatttatttagtcttcacaatatc |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25700026 |
ttttgtgaaaatagttaaactaattgcttgaatcatttagatttataaaagaacgatttatttagtcttcacaatatc |
25699949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 144 - 243
Target Start/End: Complemental strand, 53997280 - 53997182
Alignment:
| Q |
144 |
cacatacatgtagggatgatattgagtatctatgggtaaaataatatgatatttctgcacatttcgttgaataaatctaacccgttgtttacttcatatc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
53997280 |
cacatacatgtagggatgatattgagtatctatgggtaaaataatatgatatttctgctcatttcgttgaataaatctaacttg-tgtttacttcatatc |
53997182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 53997423 - 53997346
Alignment:
| Q |
1 |
ttttgtgaaaatagttaaactaattgcttgaatcatttagatttataagagaacgatttatttagtcttcacaatatc |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
53997423 |
ttttgtgaaaatagttaaactaattgcttgaatcatttagatttataaaagaacgatttatttaatcttcacaatatc |
53997346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 144 - 243
Target Start/End: Original strand, 55495026 - 55495124
Alignment:
| Q |
144 |
cacatacatgtagggatgatattgagtatctatgggtaaaataatatgatatttctgcacatttcgttgaataaatctaacccgttgtttacttcatatc |
243 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||| || |||||||| |||||| |
|
|
| T |
55495026 |
cacatacatgtagggatgataatgagtatctatgggtaaaataatatgatatttgtgctcattccgttgaataaatctaactcg-tgtttactccatatc |
55495124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 9 - 77
Target Start/End: Original strand, 55494884 - 55494952
Alignment:
| Q |
9 |
aaatagttaaactaattgcttgaatcatttagatttataagagaacgatttatttagtcttcacaatat |
77 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
55494884 |
aaattgttaaactaattgattgaatcatttagacttataaaagagtgatttatttagtcttcacaatat |
55494952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University