View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_107 (Length: 246)
Name: NF0816_high_107
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_high_107 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 97; Significance: 9e-48; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 11532103 - 11532003
Alignment:
| Q |
1 |
tgtatactcgttcgccttgatttgcgacatgtcgtggatgatgtcttcactttatcttctttctttatttgggttttaggtcaccattattgctactgca |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11532103 |
tgtatactcgttctccttgatttgcgacatgtcgtggatgatgtcttcactttatcttctttctttatttgggttttaggtcaccattattgctactgca |
11532004 |
T |
 |
| Q |
101 |
a |
101 |
Q |
| |
|
| |
|
|
| T |
11532003 |
a |
11532003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 11557594 - 11557494
Alignment:
| Q |
1 |
tgtatactcgttcgccttgatttgcgacatgtcgtggatgatgtcttcactttatcttctttctttatttgggttttaggtcaccattattgctactgca |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11557594 |
tgtatactcgttcaccttgatttgcgacatgtcgtggatgatgtcttcactttatcttctttctttatttgggttttaggtcaccattattgctactgca |
11557495 |
T |
 |
| Q |
101 |
a |
101 |
Q |
| |
|
| |
|
|
| T |
11557494 |
a |
11557494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 11564463 - 11564422
Alignment:
| Q |
1 |
tgtatactcgttcgccttgatttgcgacatgtcgtggatgat |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11564463 |
tgtatactcgttcgccttgatttgcgacatgtcgtggatgat |
11564422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 121 - 154
Target Start/End: Complemental strand, 11531983 - 11531950
Alignment:
| Q |
121 |
aaataccttcatgatgttgagttcagcttgatga |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11531983 |
aaataccttcatgatgttgagttcagcttgatga |
11531950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 11532149 - 11532108
Alignment:
| Q |
1 |
tgtatactcgttcgccttgatttgcgacatgtcgtggatgat |
42 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
11532149 |
tgtatactcgttcgccttgatttgcaatatgtcgtggatgat |
11532108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 11557640 - 11557599
Alignment:
| Q |
1 |
tgtatactcgttcgccttgatttgcgacatgtcgtggatgat |
42 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
11557640 |
tgtatactcgttcgccttgatttgcaatatgtcgtggatgat |
11557599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 154
Target Start/End: Complemental strand, 11557474 - 11557441
Alignment:
| Q |
121 |
aaataccttcatgatgttgagttcagcttgatga |
154 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
11557474 |
aaataccttcatgatgttgagttcggcttgatga |
11557441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University