View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_109 (Length: 242)
Name: NF0816_high_109
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_high_109 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 40 - 131
Target Start/End: Complemental strand, 11227051 - 11226960
Alignment:
Q |
40 |
caaatacacttgaaaagcacaaccctcagcttaccatagtaatgaagttctaggatgtcatccaatttcccataatacatctcatcacttga |
131 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
11227051 |
caaacacacttgaaaagcacaaccctcagcttaccatagtaatcaagttctatgatgtcaaccaatttcccataatacatctcatcacttga |
11226960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7128 times since January 2019
Visitors: 5774