View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_116 (Length: 208)
Name: NF0816_high_116
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_high_116 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 31168964 - 31169068
Alignment:
Q |
1 |
ttctaagatgatccttgcaaagtgtaaatcaaatttgttattatttttggatttattgtcaaatgcacccctaacattgttcacttggtttcaaattctt |
100 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
T |
31168964 |
ttctaagatgatccttgcaaagtgttaatcaaatttgttattatttttggatttattgtcaaatgcactcctaacattgttcactcggtttcaaattctt |
31169063 |
T |
 |
Q |
101 |
ctctg |
105 |
Q |
|
|
||||| |
|
|
T |
31169064 |
ctctg |
31169068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University