View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0816_high_116 (Length: 208)

Name: NF0816_high_116
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0816_high_116
NF0816_high_116
[»] chr1 (1 HSPs)
chr1 (1-105)||(31168964-31169068)


Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 31168964 - 31169068
Alignment:
1 ttctaagatgatccttgcaaagtgtaaatcaaatttgttattatttttggatttattgtcaaatgcacccctaacattgttcacttggtttcaaattctt 100  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||    
31168964 ttctaagatgatccttgcaaagtgttaatcaaatttgttattatttttggatttattgtcaaatgcactcctaacattgttcactcggtttcaaattctt 31169063  T
101 ctctg 105  Q
    |||||    
31169064 ctctg 31169068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University