View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_117 (Length: 207)
Name: NF0816_high_117
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_high_117 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 31168988 - 31168904
Alignment:
| Q |
1 |
acactttgcaaggatcatcttagaatattagtaatttgagagaagagtcttaatcatctcaccaattcagccattcggatcatgt |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31168988 |
acactttgcaaggatcatcttagaatattagtaatttgagagaagagtcttaatcatctcaccaattcagccattcggatcatgt |
31168904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6160 times since January 2019
Visitors: 5762