View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_13 (Length: 600)
Name: NF0816_high_13
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 515; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 515; E-Value: 0
Query Start/End: Original strand, 15 - 573
Target Start/End: Complemental strand, 11179023 - 11178465
Alignment:
| Q |
15 |
gaggtttggcagttgcataagcaccagatatttgagattaggaagccgaagtttctgcttaggaatctcatcatgtggttcacttataaacatgtcatct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11179023 |
gaggtttggcagttgcataagcaccagatatttgagattaggaagccgaagtttctgcttaggaatctcatcatgtggttcacttataaacatgtcatct |
11178924 |
T |
|
| Q |
115 |
aaccgagaggcttcttttatgatcatgagctctaactttggaaactcttggaatgtgttgacagagatgagacttttcaaaccgtggcaactcttgatga |
214 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11178923 |
aactgagaggcttcttttatgatcatgagctctaactttggaaactcttggaatgtgttgacagagatgagacttttcaaaccgtggcaactcttgatga |
11178824 |
T |
|
| Q |
215 |
taagtgcaacaagctttggaaagcatatcagttgagattgaggaattgtctgcctttgattttcctcattgtcttccattattttatgtaatccttcaca |
314 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11178823 |
taagtgcaacgagcttcggaaagcatatcagttgagattgaggaattgtctgcctttgattttcctcattgtcttccattattttatgtaatccttcaca |
11178724 |
T |
|
| Q |
315 |
gttgctgatttctagatatgtaagttgtagtaggcttctcaagacagatgctgagaatacaactttgagtttactacatccctcaatttgtaaagttttg |
414 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11178723 |
gttgctgatttctagatatgtaagttgtggtaggcttctcaagacagatgctgagaatacaactttgagtttactacatccctcaatttgtaaagttttg |
11178624 |
T |
|
| Q |
415 |
acattttcgaggctcataannnnnnnnggacccatgaatgtataccttagatcatgtagattgttcaatttcaaggattccaaacttgagctcatttgtt |
514 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11178623 |
acattttcgaggctcataattttttttggacccatgaatgtataccttagatcatgtagattgttcaatttcaaggattgcaaacttgagctcatttgtt |
11178524 |
T |
|
| Q |
515 |
gagcaatggttggatgttcttcaagacaaaatatcccttgaatccctgagttctctatg |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11178523 |
gagcaatggttggatgttcttcaagacaaaatatcccttgaatccctgagttctctatg |
11178465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6791 times since January 2019
Visitors: 5771