View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_14 (Length: 564)
Name: NF0816_high_14
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 9e-93; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 9e-93
Query Start/End: Original strand, 30 - 202
Target Start/End: Complemental strand, 43914966 - 43914794
Alignment:
| Q |
30 |
ggattagcaaagggtaatatttgttaattaaccgggatttggaaatatcatgctaaaaaataagtttgattaagctcataaataaatagattcctgtcat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43914966 |
ggattagcaaagggtaatatttgttaattaaccgggatttggaaatatcatgctaaaaaataagtttgattaagctcataaataaatagattcctgtcat |
43914867 |
T |
 |
| Q |
130 |
gctttgtgtctaatttttgcagcatgtcgttcacatgtgttttaaaatcgttcagtatctgtgtctagatata |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43914866 |
gctttgtgtctaatttttgcagcatgtcgttcacatgtgttttaaaatcgttcagtatctgtgtctagatata |
43914794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 267 - 381
Target Start/End: Complemental strand, 43914729 - 43914615
Alignment:
| Q |
267 |
catgatttgttgtttttaagattatacatacatatttgaaaagtattgtatgtttttaaattattttgctgaaatttataaattagtacatatatttcga |
366 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43914729 |
catgatttgttgttttttagattatacatacatatttgaaaagtattgtatgtttttaaattattttgctgaaatttataaattagtacatatatgtcga |
43914630 |
T |
 |
| Q |
367 |
gaatacaaaatattg |
381 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43914629 |
aaatacaaaatattg |
43914615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 448 - 488
Target Start/End: Complemental strand, 43914550 - 43914510
Alignment:
| Q |
448 |
cccctgtaatattagcgattttcgatttaccctgtaaaaac |
488 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43914550 |
cccctgtaatattagcgattttcggtttaccctgtaaaaac |
43914510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 448 - 478
Target Start/End: Complemental strand, 25125112 - 25125082
Alignment:
| Q |
448 |
cccctgtaatattagcgattttcgatttacc |
478 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25125112 |
cccctgtaatattagcgattttcgatttacc |
25125082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University