View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_34 (Length: 409)
Name: NF0816_high_34
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 1e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 205 - 362
Target Start/End: Complemental strand, 19530296 - 19530141
Alignment:
| Q |
205 |
ggtgaaaatatcaaagacttacttgttccctgaggaattcatcattgactcctcaaccatgttggaactagcaccatcaacagcaataggagaagattct |
304 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19530296 |
ggtgaaaatatca--gacttacttgtttgctgaggaattcatcattgacccttcaaccatgtttgaactagcaccatcaacagcaataggagaagattct |
19530199 |
T |
 |
| Q |
305 |
agaacagtaaactgctctggctcaaccttaacagtaacaccatccattttttgaagaa |
362 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
19530198 |
agaacagtaaactgctctggctcaaacttaacagtaacaccatccatcttttgaagaa |
19530141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University