View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_46 (Length: 353)
Name: NF0816_high_46
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_high_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 30 - 345
Target Start/End: Original strand, 43297500 - 43297822
Alignment:
| Q |
30 |
ccaagaagcgtttgcaaaatctggctgatcgggttggttcaacaagttgaactagaaatcgacactactttgtcggttggtttgatttcagttatacttc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43297500 |
ccaagaagcgtttgcaaaatctggctgatcgggttggttcaacaagttgaactagaaatcgacactactttgtcggttggtttgatttcagttatacttc |
43297599 |
T |
|
| Q |
130 |
actctcattgaatcatattaaactgggttaatactcttacatataattgatttagttcattcctaatcaa-------tgtgaaactaaccacttacacat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
43297600 |
actctcattgaatcatattaaactgggttaatactcttacatataattgatttagttcattcgtaatcaatgtgaattgtgaaactaaccacttacacat |
43297699 |
T |
|
| Q |
223 |
aaatttcaacactgtctataccattaggctaaggttgtacattactgtaagaatgagtgaagcttaccactgcaacgtcccattagcttcacaataccga |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43297700 |
aaatttcaacactgtctataccattaggctaaggttgtacattactgtaagaatgagtgaagcttaccactgcaacgtcccattagcttcacaacaccga |
43297799 |
T |
|
| Q |
323 |
taccattctcagcactctctgct |
345 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43297800 |
taccattctcagcactctctgct |
43297822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7100 times since January 2019
Visitors: 5774