View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_63 (Length: 312)
Name: NF0816_high_63
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_high_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 30 - 295
Target Start/End: Original strand, 17323240 - 17323506
Alignment:
Q |
30 |
gaaattaccatgcatagggcagcctaacacatttatgttccagcaatccacaataaattctttcaagccttcatggagagtccacattttaagaaactta |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17323240 |
gaaattaccatgcatagggcagcctaacacatttatgttccagcaatccacaataaactctttcaagccttcatggagagtccacattttaagaaactta |
17323339 |
T |
 |
Q |
130 |
aaatttgaagaaaaatggtttatgtcagttttgaactcaaaaagcaatggataatgatctgatttattcctcacaataaactctagttggaagatgaata |
229 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17323340 |
aaatttgaagaaaaatggtttatgtcaattttgaactcaaaaagcaatggataatgatctgatttattcctcacaataaactctagttggaagatgaata |
17323439 |
T |
 |
Q |
230 |
agtccactgctgtcagtccattggaggtctagcatgtgtgaatcttcgactgtgctc-tgtgctcct |
295 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
T |
17323440 |
agtccactgctgtcagtccattggaggtctagcatgtgtgaatcttccactgtgctcatgtgctcct |
17323506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6422 times since January 2019
Visitors: 5768