View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_64 (Length: 309)
Name: NF0816_high_64
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_high_64 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 5e-59; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 16 - 139
Target Start/End: Complemental strand, 13692922 - 13692799
Alignment:
Q |
16 |
atatgaataaacagttatgagtgtaacctttactcctttctctatcaaacgctttgagaattgaatcataggattcatatgtccttgtgctggataaggt |
115 |
Q |
|
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13692922 |
atatgaataaacagttatcaatgtaacctttactcctttctctatcaaacgctttgagaattgaatcataggattcatatgtccttgtgctggataaggt |
13692823 |
T |
 |
Q |
116 |
aagatcagacagtgagctacatgg |
139 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
13692822 |
aagatcagacagtgagctacatgg |
13692799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 29 - 131
Target Start/End: Complemental strand, 13686448 - 13686346
Alignment:
Q |
29 |
gttatgagtgtaacctttactcctttctctatcaaacgctttgagaattgaatcataggattcatatgtccttgtgctggataaggtaagatcagacagt |
128 |
Q |
|
|
||||| ||||| | |||||||||||||||||| ||||| |||||||||||||||||||| ||||| || ||||||||||||||||||||||| ||||||| |
|
|
T |
13686448 |
gttattagtgttatctttactcctttctctattaaacgttttgagaattgaatcatagggttcatgtggccttgtgctggataaggtaagatgagacagt |
13686349 |
T |
 |
Q |
129 |
gag |
131 |
Q |
|
|
||| |
|
|
T |
13686348 |
gag |
13686346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 137
Target Start/End: Original strand, 13673473 - 13673575
Alignment:
Q |
35 |
agtgtaacctttactcctttctctatcaaacgctttgagaattgaatcataggattcatatgtccttgtgctggataaggtaagatcagacagtgagcta |
134 |
Q |
|
|
|||||||| ||||||||||| | |||||||| |||||||||||||||||||||||||| || ||||| ||||| |||||||||||||||||||||||| |
|
|
T |
13673473 |
agtgtaacttttactcctttatggatcaaacgttttgagaattgaatcataggattcatgtgaccttgacctggaaaaggtaagatcagacagtgagcta |
13673572 |
T |
 |
Q |
135 |
cat |
137 |
Q |
|
|
||| |
|
|
T |
13673573 |
cat |
13673575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 13692759 - 13692716
Alignment:
Q |
179 |
ttcctaacaaaatacatctatgcactttagttacatatacatat |
222 |
Q |
|
|
||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
T |
13692759 |
ttcctaataaaatacatctatgtactttagttacatatacatat |
13692716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 36 times since January 2019
Visitors: 5776