View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_67 (Length: 308)
Name: NF0816_high_67
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_high_67 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 30 - 165
Target Start/End: Original strand, 2410486 - 2410621
Alignment:
| Q |
30 |
atgaccaaaaccaaaatcaataaaacaagtcaggtctagaagatacccgaagaacaaaattcttgtaaattgcttcagaatcaaactcttcttcatgctt |
129 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2410486 |
atgaccaaaaccaaaatcaataaagcaagtcaggtctagaagatacccgaagaacaaaattcttgtaaattgcttcagaatcaaactcttcttcatgctt |
2410585 |
T |
|
| Q |
130 |
ttggtcacatcctgagaattgagttccaattatcaa |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2410586 |
ttggtcacatcctgagaattgagttccaattatcaa |
2410621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 202 - 295
Target Start/End: Original strand, 2410618 - 2410711
Alignment:
| Q |
202 |
tcaaaatgaaaacatctacaacactacatatccaatgtcagacacatatgtgaatgtctgacacggacacatgtcactattgtgtctggtgtct |
295 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2410618 |
tcaaaatgaaaacatctacaacactgcatatccaatgtgagacacatatgtgaatgtctgacacggacacatgtcactattgtgtctggtgtct |
2410711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6331 times since January 2019
Visitors: 5767