View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0816_high_78 (Length: 273)

Name: NF0816_high_78
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0816_high_78
NF0816_high_78
[»] chr4 (2 HSPs)
chr4 (73-177)||(31952122-31952230)
chr4 (16-50)||(31952229-31952263)


Alignment Details
Target: chr4 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 73 - 177
Target Start/End: Complemental strand, 31952230 - 31952122
Alignment:
73 cagaatgccagcactttcaatgacttttgtcatcctccttctgcagaagaaatcagaatagggac----attactcactacatcttggctgtatttgtaa 168  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||    
31952230 cagaatgccagcactttcaatgacttttgtcatcctccttctgcagaagaaatcagaatagggacattaattactcactacatcttggctgtatttgtaa 31952131  T
169 gttggtttg 177  Q
    |||||||||    
31952130 gttggtttg 31952122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 16 - 50
Target Start/End: Complemental strand, 31952263 - 31952229
Alignment:
16 ttcaagggagtcaatggatagaacactacaagtca 50  Q
    |||||||||||||||||||||||||||||||||||    
31952263 ttcaagggagtcaatggatagaacactacaagtca 31952229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University