View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_80 (Length: 271)
Name: NF0816_high_80
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_high_80 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 31 - 174
Target Start/End: Complemental strand, 4563296 - 4563153
Alignment:
Q |
31 |
agatgaaaagaaagaattgcagaagcagattggttgcatcactggattttttcatctctttgatcgccaccgtttcatcacaggacaacgcactactaaa |
130 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4563296 |
agatgaaaagaaagaattgcagaagcaaattggttgcatcactggattttttcagctctttgatcgccaccgtttcatcacaggacaacgcactactaaa |
4563197 |
T |
 |
Q |
131 |
tacattcagaatgcatcttctttaggtattcaattattcatatc |
174 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4563196 |
tacattcagaatgcatcttctttaggtattcaattattcatatc |
4563153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 96
Target Start/End: Complemental strand, 5027406 - 5027341
Alignment:
Q |
31 |
agatgaaaagaaagaattgcagaagcagattggttgcatcactggattttttcatctctttgatcg |
96 |
Q |
|
|
||||||||| |||||||||||||||| ||||| ||||| | |||||||||||| || |||||||| |
|
|
T |
5027406 |
agatgaaaatcaagaattgcagaagcaaattggatgcattagtggattttttcagctatttgatcg |
5027341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 96
Target Start/End: Complemental strand, 8011628 - 8011580
Alignment:
Q |
48 |
tgcagaagcagattggttgcatcactggattttttcatctctttgatcg |
96 |
Q |
|
|
||||||||||||||||||| || |||||| ||||||| ||||||||||| |
|
|
T |
8011628 |
tgcagaagcagattggttgtatgactggaatttttcagctctttgatcg |
8011580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University