View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_82 (Length: 269)
Name: NF0816_high_82
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_high_82 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 40 - 244
Target Start/End: Original strand, 12275512 - 12275716
Alignment:
Q |
40 |
ttgcacggatcaatcaggaagcttagtagtctacacgacagtcgatgttgattcggtccaactagctatgagtggacaagacccttcatgcattgcactt |
139 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12275512 |
ttgcacagatcaatcaggaagcttagtagtctacacaacagtcgatgttgattcggtccaactagctatgagtggacaagacccttcatgcattgcactt |
12275611 |
T |
 |
Q |
140 |
cttccacaagggttcatgatagtgccaatggtttcatcaaatgctgatacatcatctgaacaaggtgtcacaggaacaccatcatctactactagtgcct |
239 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
12275612 |
cttccacaagggttcatgatagtgccaatggtttcatcaaatgctgatacatcatctgaacaaggtgtcacaggaacaccatcatctactgctagtgcca |
12275711 |
T |
 |
Q |
240 |
atgct |
244 |
Q |
|
|
||||| |
|
|
T |
12275712 |
atgct |
12275716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6823 times since January 2019
Visitors: 5772