View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0816_high_91 (Length: 257)

Name: NF0816_high_91
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0816_high_91
NF0816_high_91
[»] chr3 (1 HSPs)
chr3 (1-246)||(54966943-54967188)


Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 54967188 - 54966943
Alignment:
1 agatttaaattttataaatcctggaccacttatgacagttgtgaatctctaatttctgctcattggtctgttttggctgagggaactcctatcacctatg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
54967188 agatttaaattttataaatcctggaccacttatgacagttgtgaatctctaatttctgctcattggtctgttttggctgagggaacacctatcacctatg 54967089  T
101 catattcttcactacaaattaaagactctggagcagggaagttgatcagttgggttccaacaatgctagaaatcaggaagagtttgaatgcatgtccaga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54967088 catattcttcactacaaattaaagactctggagcagggaagttgatcagttgggttccaacaatgctagaaatcaggaagagtttgaatgcatgtccaga 54966989  T
201 tacattcaggctcttggagggataaagctaaatgtgtcaagttcat 246  Q
    |||||||||||||||||| |||||||||||||||||||||||||||    
54966988 tacattcaggctcttggaaggataaagctaaatgtgtcaagttcat 54966943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University