View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_91 (Length: 257)
Name: NF0816_high_91
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_high_91 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 54967188 - 54966943
Alignment:
Q |
1 |
agatttaaattttataaatcctggaccacttatgacagttgtgaatctctaatttctgctcattggtctgttttggctgagggaactcctatcacctatg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
54967188 |
agatttaaattttataaatcctggaccacttatgacagttgtgaatctctaatttctgctcattggtctgttttggctgagggaacacctatcacctatg |
54967089 |
T |
 |
Q |
101 |
catattcttcactacaaattaaagactctggagcagggaagttgatcagttgggttccaacaatgctagaaatcaggaagagtttgaatgcatgtccaga |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54967088 |
catattcttcactacaaattaaagactctggagcagggaagttgatcagttgggttccaacaatgctagaaatcaggaagagtttgaatgcatgtccaga |
54966989 |
T |
 |
Q |
201 |
tacattcaggctcttggagggataaagctaaatgtgtcaagttcat |
246 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
54966988 |
tacattcaggctcttggaaggataaagctaaatgtgtcaagttcat |
54966943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University