View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0816_high_93 (Length: 257)

Name: NF0816_high_93
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0816_high_93
NF0816_high_93
[»] chr4 (1 HSPs)
chr4 (30-257)||(34962283-34962510)


Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 30 - 257
Target Start/End: Complemental strand, 34962510 - 34962283
Alignment:
30 gttcccgccatcagagactgatccgatcgatttcacggagaggatggaagcgccattggtgagatgttcacgatgaagtttgttgagacgagggagggag 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34962510 gttcccgccatcagagactgatccgatcgatttcacggagaggatggaagcgccattggtgagatgttcacgatgaagtttgttgagacgagggagggag 34962411  T
130 gagagtgtggtggcgcgtgacaacactcgtgactccattgggatcaaaatgtgggaagatgataaacaagtagagagtgatatatggatgatgttggtgt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34962410 gagagtgtggtggcgcgtgacaacactcgtgactccattgggatcaaaatgtgggaagatgataaacaagtagagagtgatatatggatgatgttggtgt 34962311  T
230 tggtacctgtggttctcgttaaccgtct 257  Q
    ||||||||||||||||||||||||||||    
34962310 tggtacctgtggttctcgttaaccgtct 34962283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University