View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_high_94 (Length: 254)
Name: NF0816_high_94
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_high_94 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 54967188 - 54966943
Alignment:
| Q |
1 |
agatttaaattttataaatcctggaccacttatgacagttgtgaatctctaatttctgctcattggtctgttttggctgagggaactcctatcacctatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
54967188 |
agatttaaattttataaatcctggaccacttatgacagttgtgaatctctaatttctgctcattggtctgttttggctgagggaacacctatcacctatg |
54967089 |
T |
|
| Q |
101 |
c---tactccactacaaattaaagactctggagcagggaagttgatcagttgggttccaacaatgctagaaatcaggaagagtttgaatgcatgtccaga |
197 |
Q |
| |
|
| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54967088 |
catattcttcactacaaattaaagactctggagcagggaagttgatcagttgggttccaacaatgctagaaatcaggaagagtttgaatgcatgtccaga |
54966989 |
T |
|
| Q |
198 |
tacattcaggctcttggagggataaagctaaatgtgtcaagttcat |
243 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54966988 |
tacattcaggctcttggaaggataaagctaaatgtgtcaagttcat |
54966943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6988 times since January 2019
Visitors: 5773