View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_102 (Length: 263)
Name: NF0816_low_102
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_low_102 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 44 - 263
Target Start/End: Complemental strand, 15001174 - 15000956
Alignment:
| Q |
44 |
gggttatgtgcttgcaagccctgccgttgacctgtatcagcatgtaaacgatcaaattttatacgcatatcatatgaatcttataccaaaagaactctac |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15001174 |
gggttatgtgcttgcaagccctgccgttgacctgtatcagcatgtaaacgatcaagttttatatgcataccatatgaatcttataccaaaagaactctac |
15001075 |
T |
 |
| Q |
144 |
gaggttactttgccgttatgaatcttataatcattttcattcaacaaatctaaaaataacgactttctgtcttaatttgcatctatctatgaaggtttca |
243 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||| |||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
15001074 |
gaggttactttgccgttatgaatcgtataatcattttcattcaacaaatct-aaaattacgattttctgtcttaatttgaatctatctacgaaggtttca |
15000976 |
T |
 |
| Q |
244 |
tatttatgtgtttattaact |
263 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
15000975 |
tatttatgtgtttattaact |
15000956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University