View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_109 (Length: 257)
Name: NF0816_low_109
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_low_109 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 89 - 244
Target Start/End: Complemental strand, 1302779 - 1302624
Alignment:
Q |
89 |
gggggaagttgaagtagacttaacaacctcataatatgtaacnnnnnnnncaacctcataatataagattggatcaattgcatgcaataacagattgaat |
188 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
1302779 |
gggggaagttgaagtagacttaacaacctcataatatgtaacaaaaaaa-caacctcataatataagattggatcaattgcatgcaatatcagattgaat |
1302681 |
T |
 |
Q |
189 |
caaactcgagc-ttgcttgaaaagtaaaccctatttcttgtgtgacctatatatatt |
244 |
Q |
|
|
||||||||| | |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
1302680 |
caaactcgaactttgcttgaaaagtaaaccctattttctgtgtgacctatatatatt |
1302624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 7876617 - 7876665
Alignment:
Q |
207 |
aaaagtaaaccctatttctt-gtgtgacctatatatattttcatcgcta |
254 |
Q |
|
|
|||||||||||||||||||| ||||||| ||||||||||| |||||||| |
|
|
T |
7876617 |
aaaagtaaaccctatttcttggtgtgacttatatatatttccatcgcta |
7876665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 225
Target Start/End: Complemental strand, 8660694 - 8660666
Alignment:
Q |
197 |
agcttgcttgaaaagtaaaccctatttct |
225 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
8660694 |
agcttgcttgaaaagtaaaccctatttct |
8660666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University