View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_113 (Length: 253)
Name: NF0816_low_113
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_low_113 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 57 - 121
Target Start/End: Original strand, 31923785 - 31923849
Alignment:
Q |
57 |
gcatcgcggcggaaatgacccgggtccacctagaaaccttcttggccgatctacggagacctttg |
121 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
31923785 |
gcatcgcggcggaaatgacccgggtccacctagaaaccttcttggccaatctacggagacctttg |
31923849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University