View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_114 (Length: 252)
Name: NF0816_low_114
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_low_114 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 32672917 - 32672685
Alignment:
Q |
1 |
tgaagatttatcaaccggtgaatctgcatccttcaatatgtgctcatagttgtgtggcaaacttagttctttgatcaaaggtttggttgctgattgagtc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32672917 |
tgaagatttatcaaccggtgaatctgcatccttcaatatgtgctcatagttgtgtgacaaacttagttctttgatcaaaggtttggttgctgattgagtc |
32672818 |
T |
 |
Q |
101 |
tcattggattttacaactgtggagttttgtaccgccttcttgctggagggtgattttgtgtgatgttgaggagacaacaacagattttcccttctcgaag |
200 |
Q |
|
|
|||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
32672817 |
tcatcgcattttacaactgtggagttttgtaccgccttcttgctggagggtgattttgtgtgatattgaggagacaacaacagattttcccttctcgaag |
32672718 |
T |
 |
Q |
201 |
gtaatcgtaattcttccttattggttggttcat |
233 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
32672717 |
gtaatcgtaattcttccttattggttggttcat |
32672685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University