View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0816_low_128 (Length: 238)

Name: NF0816_low_128
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0816_low_128
NF0816_low_128
[»] chr4 (1 HSPs)
chr4 (1-175)||(7286689-7286863)
[»] chr7 (2 HSPs)
chr7 (2-76)||(8357337-8357411)
chr7 (2-76)||(8365763-8365837)


Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 7286863 - 7286689
Alignment:
1 tgtgtaacattattacacattggaatggtccctaaaatgaatatattgaaacttcaaaaatatccacaaatatctcgaaaggtaatcaagaatgaagaag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
7286863 tgtgtaacattattacacattggaatggtccctaaaatgaatatattgaaacttcaaaaatatccacaaatatctcgaaaggtaatcaagaacgaagaag 7286764  T
101 tacaaaattgaattataaaaatttaagaaaatgtgcataaggtctgcaaatagagaccgaaattgaggtgttcaa 175  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7286763 tagaaaattgaattataaaaatttaagaaaatgtgcataaggtctgcaaatagagaccgaaattgaggtgttcaa 7286689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 8357337 - 8357411
Alignment:
2 gtgtaacattattacacattggaatggtccctaaaatgaatatattgaaacttcaaaaatatccacaaatatctc 76  Q
    ||||||| | ||| |||||||||||| | ||| ||||||||||||||||||| ||||||||||||||||| ||||    
8357337 gtgtaacttgatttcacattggaatgtttcctgaaatgaatatattgaaactgcaaaaatatccacaaatctctc 8357411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 8365763 - 8365837
Alignment:
2 gtgtaacattattacacattggaatggtccctaaaatgaatatattgaaacttcaaaaatatccacaaatatctc 76  Q
    ||||||| | ||| |||||||||||||||||| |||||||||||| | |||| ||||||||||||||||| ||||    
8365763 gtgtaacttgatttcacattggaatggtccctgaaatgaatatatcgtaactacaaaaatatccacaaatttctc 8365837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5068 times since January 2019
Visitors: 5754