View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_132 (Length: 218)
Name: NF0816_low_132
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_low_132 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 121 - 218
Target Start/End: Complemental strand, 3424705 - 3424608
Alignment:
Q |
121 |
gtatgccatttttctaacctttagtgctaactccatgcaatttgaagaaacatccaccattgcttctttaattttgacaaggatgtagaagtcgaatt |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3424705 |
gtatgccatttttctaacctttagtgctaactccatgcaatttgaagaaacatccaccattgcttctttaattttgacaaggatgtagaagtcgaatt |
3424608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 122 - 216
Target Start/End: Original strand, 11916705 - 11916799
Alignment:
Q |
122 |
tatgccatttttctaacctttagtgctaactccatgcaatttgaagaaacatccaccattgcttctttaattttgacaaggatgtagaagtcgaa |
216 |
Q |
|
|
|||| |||||||||||||||||||| |||||| ||||||||||| |||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
11916705 |
tatgacatttttctaacctttagtgttaactctatgcaatttgaggaaacatctgccattgcttctttaatttttacaaggatgtagaagtcgaa |
11916799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 186
Target Start/End: Original strand, 35742444 - 35742493
Alignment:
Q |
137 |
acctttagtgctaactccatgcaatttgaagaaacatccaccattgcttc |
186 |
Q |
|
|
||||| ||| |||||||||||||||| || |||||||||||||||||||| |
|
|
T |
35742444 |
accttaagtactaactccatgcaattggaggaaacatccaccattgcttc |
35742493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5932 times since January 2019
Visitors: 5761