View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0816_low_136 (Length: 207)

Name: NF0816_low_136
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0816_low_136
NF0816_low_136
[»] chr1 (1 HSPs)
chr1 (1-85)||(31168904-31168988)


Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 31168988 - 31168904
Alignment:
1 acactttgcaaggatcatcttagaatattagtaatttgagagaagagtcttaatcatctcaccaattcagccattcggatcatgt 85  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31168988 acactttgcaaggatcatcttagaatattagtaatttgagagaagagtcttaatcatctcaccaattcagccattcggatcatgt 31168904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6543 times since January 2019
Visitors: 5768