View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_20 (Length: 525)
Name: NF0816_low_20
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0816_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 180 - 383
Target Start/End: Complemental strand, 52053667 - 52053464
Alignment:
Q |
180 |
ttggatccctccatggagacacatatccacttcaacaacaacacatgtacagtagtgggaaaaagtgggaacaaaacaattcaagtgaaactagaaaacc |
279 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52053667 |
ttggatccctccatggagacacatatccacttcaacaacaacacatgtacagtagtgggaaaaagtgggaacaaaacaattcaagtgaaactagaaaacc |
52053568 |
T |
 |
Q |
280 |
ttacagaaaatatgaatgaactactagagtctagtactagtactacattattattgaccttagattcaattaaaaggaacccatccataattgaaatcca |
379 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52053567 |
ttacagaaaatatgaatgaactactagagtctagtactagtactacattattattgaccttagattcaattaaaaggaacccatccataattgaaatcca |
52053468 |
T |
 |
Q |
380 |
agct |
383 |
Q |
|
|
|||| |
|
|
T |
52053467 |
agct |
52053464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 23 - 114
Target Start/End: Complemental strand, 52053824 - 52053733
Alignment:
Q |
23 |
cacatacgtgtgtgatgtgtctttgaatataagctgaaacagacacggccaaataactggtagagtctggaaactgaaaccatgtttggcag |
114 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
T |
52053824 |
cacatacgtgtgtgatgtgtctttgaatataagctgaaacagacacggccaaataactggtagagtctgaaaactgaaatcatgtttggcag |
52053733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6214 times since January 2019
Visitors: 5763