View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0816_low_37 (Length: 421)
Name: NF0816_low_37
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0816_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 30 - 262
Target Start/End: Complemental strand, 39964348 - 39964116
Alignment:
| Q |
30 |
tttgcaacaatagtactttgtaaaggacaacactccttttgttattgttgttgttttgtggtggtgacgtctctcttgttctgtccacgagccatttatt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39964348 |
tttgcaacaatagtactttgtaaaggacaacactccttttgttattgttgttgttttgtggtggtgacgtctctcttgttctgtccacgagccatttatt |
39964249 |
T |
 |
| Q |
130 |
atacattcaataatgtaaatatgtgatgtttgtctttttactgtcnnnnnnnaatctataatattgctgcttttaaaaatgaacaataaacttttttaag |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39964248 |
atacattcaataatgtaaatatgtgatgtttgtctttttactgtctttttttaatctataatattgctgcttttaaaaatgaacaatgaacttttttaag |
39964149 |
T |
 |
| Q |
230 |
gactttaaatatattaaaccttaataatatata |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39964148 |
gactttaaatatattaaaccttaataatatata |
39964116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University