View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0816_low_39 (Length: 409)

Name: NF0816_low_39
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0816_low_39
NF0816_low_39
[»] chr2 (1 HSPs)
chr2 (205-362)||(19530141-19530296)


Alignment Details
Target: chr2 (Bit Score: 119; Significance: 1e-60; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 205 - 362
Target Start/End: Complemental strand, 19530296 - 19530141
Alignment:
205 ggtgaaaatatcaaagacttacttgttccctgaggaattcatcattgactcctcaaccatgttggaactagcaccatcaacagcaataggagaagattct 304  Q
    |||||||||||||  ||||||||||||  |||||||||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||||||    
19530296 ggtgaaaatatca--gacttacttgtttgctgaggaattcatcattgacccttcaaccatgtttgaactagcaccatcaacagcaataggagaagattct 19530199  T
305 agaacagtaaactgctctggctcaaccttaacagtaacaccatccattttttgaagaa 362  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||    
19530198 agaacagtaaactgctctggctcaaacttaacagtaacaccatccatcttttgaagaa 19530141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5202 times since January 2019
Visitors: 5755